Cómo fue la carrera científica contrarreloj frente al virus

Alberto Sicilia

23 junio 2020

El virus de la viruela fue también uno de los principales aliados de los españoles durante la conquista de los imperios inca y azteca. Sin la inmunidad al virus que sí tenían los europeos, millones de habitantes indígenas fallecieron en sucesivas olas de pandemias que arrasaron el continente.

Esta vez nuestra historia comienza en los últimos meses de 2019. A los hospitales de Wuhan empiezan a llegar pacientes con neumonía. Hasta ahí nada extraño. Wuhan es una ciudad de 19 millones de habitantes, era pleno invierno y las neumonías son comunes.

Pero había algo misterioso en esas neumonías: los pacientes daban negativo a los tests ante todos los virus anteriormente conocidos. Resulta difícil reconstruir qué sucedió exactamente durante las siguientes semanas. En las redes sociales chinas aparecían testimonios de médicos que advertían sobre una tormenta sanitaria que se acercaba, pero eran inmediatamente borrados por los censores gubernamentales.

Científicos de todo el mundo empezaron a tener noticias de que algo preocupante estaba sucediendo el 31 de diciembre de 2019. Ese día apareció un mensaje en ProMED, un foro virtual en el que postean investigadores en virología: “Se están detectando neumonías de origen desconocido en la ciudad de Wuhan”.

El 8 de enero de 2020, las autoridades chinas anunciaron oficialmente que habían detectado y aislado un nuevo virus asociado a las neumonías. El virus pertenecía a la familia de los “coronavirus”.

Conocemos los coronavirus desde 1964 gracias a los trabajos de June Almeida, una mujer extraordinaria. Hija de un conductor de autobús en la Escocia de postguerra, dejó la escuela a los 16 años. Para llevar algo de sustento a casa, Almeida aceptó un trabajo como aprendiz en el laboratorio de histología del Royal Hospital de Glasgow.

Allí comenzaría una de las carreras científicas más fascinantes del siglo XX. Los “coronavirus” fueron bautizados por Almeida con ese nombre por el aspecto que presentan vistos al microscopio: una especie de esferitas con espinas alrededor, a la manera de la corona solar. Hasta ahora conocíamos seis coronavirus que infectaban al ser humano. Cuatro de ellos circulan continuamente y están relacionados con el resfriado común. Pero otros dos, los llamados “virus del SARS” y el “virus del MERS”, tienen una alta letalidad.

Los países del sudeste asiático fueron los primeros en ponerse en marcha. Tenían fresco en su memoria lo sucedido 17 años antes con el virus del SARS. En diciembre del año 2002, un nuevo coronavirus que también apareció en China mató a más de 700 personas en la región. Con el tiempo, supimos que el virus había saltado desde los murciélagos a las civetas y de ahí a los seres humanos en un mercado de animales vivos. Los investigadores localizaron incluso la cueva exacta de donde partió el murciélago que desató la pandemia.

Cuando aparece una nueva enfermedad contagiosa, los epidemiólogos consideran dos escenarios posibles: la erradicación o la contención. El primer caso es el más deseable y consiste en detectar rápidamente a todos los infectados y aislarlos hasta conseguir que el virus desaparezca completamente de la circulación entre humanos.

Eso se consiguió con el coronaviru del SARS. Desde 2004 no ha vuelto a detectarse ningún caso en el mundo. A la covid-19 llegamos demasiado tarde. El brote no pudo llegar en peor momento: a mediados de enero se celebraba el Año Nuevo Chino y se iniciaban las vacaciones anuales: cientos de millones de personas viajaron durante las semanas siguientes. La erradicación ya era imposible. El mundo entró entonces al escenario de la contención: minimizar en lo posible las nuevas transmisiones, aunque no pudiera frenarse del todo.

Conocer el genoma del virus fue el primer gran paso científico. Los virus son unos seres microscópicos extraños: no pueden reproducirse por sí mismos, necesitan introducirse en las células humanas para utilizar su maquinaria y multiplicarse. El genoma del virus es su manual de instrucciones.

El 11 de enero, los científicos chinos hicieron pública la secuencia genética del virus. En el caso del nuevocoronavirus se trata de una secuencia de 30.000 letras que empieza así “attaaaggtttataccttcc…”. Ese código genético contiene toda la información necesaria para crear nuevos virus a partir del original.

Una vez supimos el código genético del virus, se abrieron nuevas oportunidades para combatirlo. La primera y más importante es que somos capaces de detectarlo. Las famosos tests PCR de los que tanto hablaríamos durante las siguientes semanas se basan en tomar un muestra de un paciente sospechoso y buscar en ella la presencia de la secuencia genética. Además, analizando las pequeñas mutaciones que se producen entre diferentes pacientes, también aprendimos cómo el virus se había propagado por el mundo.

Pero aún así, quedaban muchas preguntas por resolver: ¿Cuál era el mecanismo exacto de la transmisión entre humanos? ¿Y la tasa de letalidad? ¿Era peor que una gripe? ¿Alguno de los medicamentos conocidos hasta ahora funcionaría frente al nuevo virus? ¿Cómo desarrollar una vacuna que nos proteja en el futuro?

Durante los últimos tres meses, investigadores de todo el mundo han establecido una colaboración sin precedentes para responder a estas cuestiones. Las revistas científicas más prestigiosas han eliminado sus muros de pago para que todo el mundo tenga acceso a los últimos avances.

Los investigadores han tenido que enfrentarse además a una epidemia adicional: la de los bulos, la desinformación y las teorías de la conspiración. Una de las más extendidas afirma que China creó el virus en un laboratorio. Todos los estudios científicos señalan lo contrario. Fue una transmisión natural de los animales al ser humano, como ha ocurrido tantas veces en la historia. Y cada vez que ha sucedido, las teorías de la conspiración han florecido. Sólo hay que darse un paseo por internet para encontrar las decenas de explicaciones chifladas que proliferaron cuando apareció el virus del sida en los años 80. Todas ellas eran erróneas y ya, afortunadamente, olvidadas.

Por delante nos quedan muchas asuntos científicos que estudiar y comprender sobre el coronavirus. El más urgente, sin duda, es el desarrollo de una vacuna. Pero también se abrirán debates éticos, políticos y morales. Por ejemplo: ¿Estamos dispuestos a ceder el control de nuestra privacidad para el trazado de contagiados y frenar nuevas epidemias? El avance científico es una condición imprescindible para resolver esta crisis, pero no suficiente.

Lee el especial completo  ‘…Y llegó la pandemia’  en este enlace

Si quieres recibir esta publicación impresa en tu domicilio, únete a La República de Público